Using fecal DNA metabarcoding to test if diet of migratory birds is correlated with Pb exposure level at a contaminated site in north Idaho: CO1 dataset
L o a d i n g
Organization
United State Environmental Protection Agency - view all
Update frequencyunknown
Last updated4 weeks ago
OverviewAmplicon-sequencingBirdsCO1Pb toxicity
Fecal samples from migratory birds were collected from contaminated wetlands in the Bunker Hill Lower Basin Coeur ’d Alene River Watershed and from a Hepton Lake reference area St. Joe River Watershed during 2022-2024. Mitochondrial CO1 metabarcoding was used to confirm bird taxa from which samples were collected. CO1 primers with Illumina adaptors: CO1-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAACATTCAGCCATCTTACCCGTG CO1-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACAGGGAGTGATAGRAGKAGTAGG Also, chloroplast rbcL metabarcoding was used to identify plant taxa recently consumed by the birds, which can be found at DOI: 10.23719/1532393
Additional Information
KeyValue
Dcat Modified2025-06-26
Dcat Publisher NameU.S. EPA Office of Research and Development (ORD)
Guidhttps://doi.org/10.23719/1532394
Harvest Object Idfbc11b9a-338d-49e6-b127-e5f1388d5678
Harvest Source Idb8e63f83-bbb9-45d3-a3de-09607cc9ff8a
Harvest Source TitleUSEPA Environmental Dataset Gateway
